Understanding DNA in only 10 Minutes!


Ever since deoxyribonucleic acid (DNA) was first discovered by Friedrich (Fritz) Miescherit DNA has been extensively researched. However, it wasn't until the late 1950s whereby Francis Crick and James Watson discovered the structure of DNA is referred to as the central Dogma explaining how information from DNA is transcribed and passed on to become a protein by which proteins are referred to as the building blocks of life. Leading on from this initiated a race to be the first to sequence the whole human genome known as the human genome project, which was completed 13 years later in April 2003.

So, why is it important to know the structure of the human genome?

This is important because when you try to fix something it's important to know how it originally looked, which allows scientists to understand if a gene has been mutated, or if gene type exposes a person of higher risk of certain diseases. A famous gene you may know of is the BRCA1 and 2, and its relationship with breast cancer. These genes in the science industry are referred to as tumour suppressors, so mutations in these proteins may cause the gene to produce inadequate proteins. Therefore, this allows scientists to complete a gene screening test to determine whether individual women have a harmful mutation in their BRCA1 or 2 genes, which in most cases had been acquired hereditary. As we know women with these types of mutations will have a risk of obtaining breast cancer than women who do not. Knowing this allows doctors to carry out extra check-ups throughout the patient’s life and allows them to act on the information however the feel.

So knowing all this, the question is posed as to how easy is it to read DNA, well let me show you!
As mentioned in the late 1950s Watson and Crick published a two paged paper explaining the structure of DNA elaborating on the four nitrogen bases as we know today.

So, let’s just clarify the components of DNA.  The helical structure is comprised of molecules called nucleotides; all the nucleotides together create a sugar-phosphate backbone. This is due to each individual nucleotide having a sugar base attached to a phosphate which then binds to the nucleotide above and below via the same method (sugar-phosphate-sugar-phosphate and so on). As you can see in the image, also bound to the sugar bases are the nitrogen bases which make up the centre of the double-helical structure, you must remember that there are two strands bound together via these nitrogen bases.

AD
Interesting facts about the Human Body £3.99
 
There are four types of nitrogen bases, and they are very fussy only wanting to bind to a specific base, which allows them to be categorised.  The first category is known as purines, these bases consist of Adenine (A) and Guanine (G). The second group are referred to as pyrimidines these being Cytosine (C), and Thymine (T). As you may have noticed each nitrogen base has been allocated a letter, using these letters will make the following much easier to understand.

So, why are they so fussy, well it so happens that G will only bind to C, and A will only bind to T. Knowing this allows scientist to predict the opposite strand by just looking at the one strand. Try it yourself with the image below; just match the letter (base) with the base that it is complementary too. For example under A would be a T.

AGCTTTCAAGGCCCTGACGCATAAC

Okay, so now we are getting somewhere, but what has all of this got to do with proteins. Well, to understand this we need to learn about another strand. You may have heard of ribonucleic acid or its shorter name RNA. The importance of this strand is immense; it allows information from the DNA to be passed on outside of the cell’s nucleus, enabling the DNA to stay very safe and protected, unless it’s viral DNA/RNA, but that’s another story.

Anyway, let’s pretend that you have just eaten some food containing sugar, by which your blood sugar levels have risen. To lower the blood sugar levels the beta cells in the pancreas need to act fast and produce insulin to allow other cells to uptake the glucose. The high external blood sugar levels will be detected via receptors on the beta cells surface, which will then stimulate an internal messenger reaction causing proteins to interact like a cascade or domino effect. Eventually, the final protein will stimulate the DNA to begin to replicate the gene that makes the insulin protein. As it replicates it makes a messenger RNA strand (mRNA), a single strand identical to the DNA strand. However, there is a slight difference in one of the nitrogen bases. When mRNA is produced the base thymine is changed to uracil (U). Just to clarify, uracil and thymine both bind to Adenine, but T is only present in DNA and U represents T in mRNA. Most scientists believe Uracil is produced as a replacement because it is less energetically expensive. These mRNA strands carrying the instructions to build insulin will keep being produced until the messenger signal is cut off. This allows for the demand for insulin in the blood to be met, but you must also remember that there are many other beta cells that have also detected the high blood sugar levels.

Now the nascent mRNA strand has been produced the strand will undergo further maturation via splicing, this process occurs to remove the introns a part of the gene that is not required, basically, the gene just gets tidies up. For example, a sentence wouldn’t make sense if random words were placed in between the other words, you would need to remove the unwanted words to understand the sentence.

Finally, the mature mRNA strand is able to leave the nucleus into the cytoplasm, where the strand will bind to a ribosome and the protein will be produced. Just to mention proteins leaving the cell will need to be feed into the endoplasmic reticulum (ER) which allows for the extra help with folding with the aid of chaperone cells plus the ER represents conditions outside of the cell.

So how do we read DNA if we wanted to make proteins?

Well to do this you must become the ribosome……

Okay, a little too much, but focusing on the ribosome and its job role helps us understand. Basically, as soon as the ribosome binds to the mRNA strand it begins matching the nitrogen bases with amino acids. But the ribosome does this through pairing codons with anti-codons, a codon is three bases on the mRNA strand and an anticodon is a three base tRNA sequence found bound to each amino acid. So as mentioned nitrogen bases only bind to specific nitrogen bases, therefore those nitrogen bases that match those nitrogen bases on the mRNA strand will be chosen. As each codon bind to each other, the amino acids begin to form a protein chain also known as a peptide, this chain will become folded and will eventually mature and be released into the bloodstream as insulin, well in this case at least.

Just to clarify when reading DNA sequences allows scientists to learn what amino acids are used and what the protein will appear to look like. This is also because each amino acid has its own characteristics, which in turn produces specific binding to other amino acids creating folds in the protein. By looking at DNA sequences finding the start codon most commonly being A-U-G which is matched with the methionine amino acid. Well actually the sequence is found many bases along, but let’s not confuse things further. Leading from this point you can then match every three bases with an amino acid until you find a stop codon.

Also, remember that T is replaced with U!

Try it yourself using these made-up sequences and the codon chart below; trust me it is great fun. I have done two made up short DNA sequences one being normal and the other being a faulty gene that leads to some sort of disease state (let’s pretend), so see if you can find the abnormal amino acid and save the day.

AAAAACCAUGUCUUAUUGUAGAGGGGGAGUCUUUUUGACUACGAACAGGCGGUGUUAAGAAAAAAA

AAAAACCAUGUCUUAUUGUAGAGGGGGAGUCUAUUUGACUACGAACAGGCGGUGUUAAGAAAAAAA


Comments

Popular Posts